Stem Cell Therapy – Hype or Hope? A Review
Acute lung injury (ALI) is a pulmonary disorder that causes astute respiratory failure, thus leading to relative high mortality worldwide. Notwithstanding, the molecular mechanisms of ALI remain largely unknown. MicroRNA (miRNA)-dependent control of gene expression at a mail-transcriptional level has been recently reported. Herein, we identify a candidate miRNA, miR-495, that affects the progression of ALI. Alveolar macrophages (NR8383) were treated with i μg/mL lipopolysaccharide (LPS) to institute a jail cell-injury model. Combined with the information from western absorb, methylation-specific PCR, methylated DNA immunoprecipitation, and chromatin immunoprecipitation assays, NLRP3 inflammasome activation and methylation-dependent repression of miR-495 were found in LPS-exposed NR8383 cells. Dual-luciferase reporter gene assay and miR-495 gain-of-office experiments confirmed that NLRP3 was a target of miR-495. Next, the expression of miR-495 and NLRP3 was overexpressed or silenced to appraise their furnishings on NLRP3 inflammasome activation, alveolar macrophage inflammation, and pyroptosis in vitro. As demonstrated, overexpressed miR-495 alleviated alveolar macrophage inflammation and pyroptosis and inhibited NLRP3 inflammasome activation by negatively regulating the NLRP3 gene. Consistently, elevated miR-495 alleviated lung injury and reduced the neutrophil infiltration and inflammation in rat models of LPS-induced ALI. Taken together, the data in our study demonstrated that methylation of the miR-495 promoter could downregulate miR-495, whose acme could benumb the activation of the NLRP3 inflammasome to protect confronting ALI, which provides novel therapeutic targets for ALI handling.
Keywords
- acute lung injury
- microRNA-495
- NOD-like receptor family pyrin domain containing 3
- methylation
- inflammasome
Introduction
Acute lung injury (ALI) is a prevalent and life-threatening affliction resulting from an acute injury such as pneumonia, shock, sepsis, or aspiration.
i
- Lemos-Filho 50.B.
- Mikkelsen Grand.E.
- Martin G.S.
- Dabbagh O.
- Adesanya A.
- Gentile N.
- Esper A.
- Gajic O.
- Gong Chiliad.N.
United states Disquisitional Disease and Injury Trials Grouping: Lung Injury Prevention Report Investigators (USCIITG-LIPS)
Sexual practice, race, and the development of acute lung injury.
- Abstract
- Full Text
- Full Text PDF
- PubMed
- Scopus (21)
- Google Scholar
ALI causes lung injuries characterized by edema and injury to the lung tissues; impaired gas exchange; and astringent inflammatory responses leading to diffuse alveolar injury, serious hypoxemia, and sub-par lung compliance.
,
Owing to insufficient management and intricate pathogenesis, ALI accounts for high morbidity and bloodshed rates associated with acute respiratory failure worldwide.
4
- Czyzewski A.M.
- McCaig Fifty.K.
- Dohm M.T.
- Broering Fifty.A.
- Yao L.J.
- Brown N.J.
- Didwania K.Thou.
- Lin J.S.
- Lewis J.F.
- Veldhuizen R.
- Barron A.E.
Effective in vivo handling of astute lung injury with helical, amphipathic peptoid mimics of pulmonary surfactant proteins.
- Crossref
- PubMed
- Scopus (16)
- Google Scholar
,
Although ALI and acute respiratory distress syndrome (ARDS) have been extensively explored for decades, several efforts in exploring therapeutic strategies and measures have ended upward in failure.
Moreover, patients who survive ALI are frequently confronted with long-term physical impairments.
vii
- Needham D.One thousand.
- Wozniak A.W.
- Hough C.Fifty.
- Morris P.E.
- Dinglas V.D.
- Jackson J.C.
- Mendez-Tellez P.A.
- Shanholtz C.
- Ely Eastward.Due west.
- Colantuoni Eastward.
- et al.
Risk factors for physical damage afterwards acute lung injury in a national, multicenter study.
- Crossref
- PubMed
- Scopus (113)
- Google Scholar
All in all, it is significant to develop novel and constructive therapeutic targets for ALI to heighten the quality of life of ALI-plagued patients.
MicroRNAs (miRNAs) are a group of brusque non-coding RNAs that participate in the processes of many lung diseases, including ALI.
For instance, lung inflammation, vascular permeability, and neutrophil infiltration in ALI induced past lipopolysaccharide (LPS).
9
- Fang Y.
- Gao F.
- Hao J.
- Liu Z.
microRNA-1246 mediates lipopolysaccharide-induced pulmonary endothelial cell apoptosis and acute lung injury by targeting angiotensin-converting enzyme two.
- PubMed
- Google Scholar
In addition, Ai et al.
indicated that miR-495 acts as a tumor suppressor, serving equally a promising target for the treatment of lung cancer. Furthermore, NOD-like receptor family unit pyrin domain containing iii (NLRP3) has too been highlighted as a putative target of miR-495 past bioinformatic prediction. NLRP3 is regarded as an intracellular signaling molecule that is implicated in the inflammatory response and development of lung diseases.
xi
- Coll R.C.
- Robertson A.A.
- Chae J.J.
- Higgins Due south.C.
- Muñoz-Planillo R.
- Inserra Grand.C.
- Vetter I.
- Dungan L.Southward.
- Monks B.G.
- Stutz A.
- et al.
A pocket-size-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases.
- Crossref
- PubMed
- Scopus (1261)
- Google Scholar
It was farther revealed that NLRP3 depletion influences the innate immune system, thus modulating abdominal inflammation and maintaining abdominal homeostasis.
12
- Hirota S.A.
- Ng J.
- Lueng A.
- Khajah M.
- Parhar Grand.
- Li Y.
- Lam Five.
- Potentier M.S.
- Ng K.
- Bawa M.
- et al.
NLRP3 inflammasome plays a key office in the regulation of intestinal homeostasis.
- Crossref
- PubMed
- Scopus (300)
- Google Scholar
Another interesting topic, the NLRP3 inflammasome is a complex that consists of NLRP3, apoptosis-associated speck-like protein containing a caspase activation and recruitment domain (ASC), and caspase-1. Some other study too reported that activation of the NLRP3 inflammasome may contribute to the progression of ALI.
xiii
- Yin N.
- Peng Z.
- Li B.
- Xia J.
- Wang Z.
- Yuan J.
- Fang L.
- Lu X.
Isoflurane attenuates lipopolysaccharide-induced acute lung injury by inhibiting ROS-mediated NLRP3 inflammasome activation.
- PubMed
- Google Scholar
,
14
- Jiang L.
- Zhang L.
- Kang K.
- Fei D.
- Gong R.
- Cao Y.
- Pan S.
- Zhao M.
- Zhao M.
Resveratrol ameliorates LPS-induced acute lung injury via NLRP3 inflammasome modulation.
- Crossref
- PubMed
- Scopus (77)
- Google Scholar
Based on these findings, we speculated whether the miR-495/NLRP3 axis could regulate the development of ALI. Therefore, in the nowadays study, we aimed to explore the specific mechanism by which miR-495 participates in the processes of ALI by mediating the expression of NLRP3 using both in vitro and in vivo assays based on cell and rat models of LPS-induced ALI.
Results
NLRP3 Silencing Suppresses LPS-Induced Alveolar Macrophage Inflammation
After establishing the cell models of LPS-induced injury, western blot analysis was applied to mensurate the protein expression levels of NLRP3, caspase-i, ASC, interleukin (IL)-1β, IL-18, and cleaved-gasdermin D (Cle-GSDMD) in NR8383 cells, which were all determined to exist higher in NR8383 cells treated with LPS compared to NR8383 cells treated with F-12K culture medium (p < 0.05) (Figure 1A). Side by side, the levels of proinflammatory factors tumor necrosis factor α (TNF-α), IL-6, IL-1β, and IL-xviii and of anti-inflammatory factor IL-10 in NR8383 cells were detected using ELISA, and the results revealed that LPS treatment increased the levels of the aforementioned inflammatory factors compared to F-12K culture medium handling (Figure 1B), suggesting that LPS could successfully induce ALI in alveolar macrophages and that NLRP3 was upregulated in ALI. Afterward, further assays were performed to identify the effects of NLRP3 on the expression levels of inflammation-related factors on NLRP3 silencing. As shown by western blot analysis, the protein expression levels of NLRP3, caspase-1, ASC, IL-1β, IL-18, and Cle-GSDMD in LPS-exposed NR8383 cells were noted to exist reduced as a response to treatment with brusque-hairpin-RNA (shRNA)-targeting NLRP3 (sh-NLRP3) when compared to treatment with shRNA-negative control (sh-NC; p < 0.05) (Effigy 1C). Additionally, the results of the ELISA revealed that LPS-exposed NR8383 cells transfected with short hairpin (sh)-NLRP3 exhibited downregulated expression levels of proinflammatory factors only upregulated expression of the anti-inflammatory cistron IL-x in comparison to the LPS-exposed NR8383 cells transfected with sh-NC (all p values < 0.05) (Effigy 1D). Moreover, menstruation-cytometric analysis was performed to measure the pyroptosis of NR8383 cells, which demonstrated that LPS treatment enhanced pyroptosis in NR8383 cells versus the treatment with F-12K civilisation medium; all the same, pyroptosis was attenuated following handling of LPS and sh-NLRP3 versus treatment of LPS and sh-NC (both p values < 0.05) (Figure 1E). These data revealed that NLRP3 inflammasome activation was detected in LPS-exposed NR8383 cells and that depletion of NLRP3 could ameliorate LPS-induced alveolar macrophage inflammation.
Effigy ane LPS-Induced ALI Exhibits Activated NLRP3 Inflammasome and Inflammation of Alveolar Macrophages in LPS-Induced ALI Is Inhibited with the Silencing of NLRP3
Show full caption
(A) Poly peptide expression levels of NLRP3, caspase-1, ASC, IL-1β, IL-18, and Cle-GSDMD in NR8383 cells treated with F-12K culture medium or LPS as detected by western absorb analysis. (B) Expression levels of proinflammatory factors (TNF-α, IL-6, IL-1β, and IL-18) and anti-inflammatory factor IL-x in NR8383 cells treated with F-12K culture medium or LPS every bit detected by ELISA. (C) Protein expression levels of NLRP3, caspase-1, ASC, IL-1β, IL-eighteen, and Cle-GSDMD in LPS-exposed NR8383 cells post-obit transfection with sh-NLRP3 or sh-NC as measured by western blot analysis. (D) Expression levels of proinflammatory factors (TNF-α, IL-6, IL-1β, and IL-eighteen) and anti-inflammatory factor IL-10 in LPS-exposed NR8383 cells following transfection with sh-NLRP3 or sh-NC as measured by ELISA. (E) Pyroptosis of LPS-exposed NR8383 cells following transfection with sh-NLRP3 or sh-NC, as determined by PI/Hoechst 33342 double staining. *p < 0.05 versus NR8383 cells treated with F-12K civilisation medium; #p < 0.05 versus LPS-exposed NR8383 cells transfected with sh-NC. An unpaired t test was used to analyze data expressed as mean ± SD between 2 groups if the data conformed to normal distribution and homogeneity of variance. Information amid multiple groups were compared using one-manner ANOVA followed by Tukey's post hoc test. The experiment was repeated iii times.
- View Large Image
- Figure Viewer
- Download Hi-res image
- Download (PPT)
NLRP3 Is the Target Cistron of miR-495
Bioinformatic prediction was performed in order to place the upstream miRNA interacting with NLRP3. The prediction results revealed the presence of a specific binding site between the NLRP3 gene sequence and the miR-495 sequence, suggesting that NLRP3 was a putative target gene of miR-495 (Figure 2A) and that the miR-495 sequence was conservative. The human relationship between miR-495 and NLRP3 was farther verified using a dual-luciferase reporter factor assay. The results revealed that the luciferase activity was attenuated in response to co-transfection with the miR-495 mimic and NLRP3-wild-blazon (WT) three′ UTR compared to co-transfection with mimic NC and NLRP3-WT (p < 0.05); notwithstanding, the luciferase activeness following co-transfection with miR-495 mimic and NLRP3 mutant blazon (Mut) was found to exist not significantly different from that post-obit co-transfection with mimic NC and NLRP3-Mut (p > 0.05) (Figure 2B). Moreover, as determined past qRT-PCR, the expression of miR-495 was increased in cells following miR-495 mimic transfection versus mimic NC transfection (p < 0.05) (Effigy 2C). Furthermore, the results of western blot assay indicated that cells transfected with miR-495 mimic presented with reduced expression of NLRP3 in comparison with cells transfected with mimic NC (p < 0.05) (Figure 2d). Subsequently, in order to investigate whether the interaction mechanism of miR-495 and NLRP3 was bourgeois in nature, we compared human and rat miR-495 sequences and found that miR-495 was highly conservative. Next, NR8383 cells were transfected with synthesized hsa-miR-495 mimic and its respective NC. Findings of western blot assay revealed that miR-495 mimic transfection led to a reduction in the expression levels of NLRP3 compared to mimic NC transfection (p < 0.05) (Figure 2E). Also, the stability of NLRP3 mRNA was measured past determining its expression using qRT-PCR. Information technology was revealed that NLRP3 expression was downregulated in miR-495-mimic-transfected cells versus the mimic-NC-transfected cells, suggesting that miR-495 could downregulate the expression of NLRP3 mRNA (Figure 2F). All in all, these findings suggested that miR-495 could modulate the expression of NLRP3 past influencing its stability.
Figure 2 miR-495 Directly Targets NLRP3
Show full caption
(A) Binding site between miR-495 and NLRP3 3′ UTR predicted using the bioinformatic website microRNA.org. (B) Luciferase activity of NLRP3-WT and NLRP3-Mut following the co-transfection of miR-495 mimic or mimic NC detected by dual-luciferase reporter gene analysis. (C) Expression of miR-495 in response to transfection with miR-495 mimic or mimic NC as measured by qRT-PCR. (D) Expression of NLRP3 in response to transfection with miR-495 mimic or mimic NC every bit measured by western absorb analysis. (Due east) Poly peptide expression of NLRP3 in response to transfection with hsa-miR-495 mimic or mimic NC equally measured by western absorb assay. (F) Expression of NLRP3 in response to transfection with hsa-miR-495 mimic or mimic NC determined by qRT-PCR. *p < 0.05 versus NR8383 cells treated with mimic NC. Measurement data were expressed as mean ± SD. An unpaired t test was used to analyze information expressed as hateful ± SD between 2 groups if the data conformed to normal distribution and homogeneity of variance. The experiment was repeated three times to obtain the hateful value.
- View Large Image
- Figure Viewer
- Download Hello-res image
- Download (PPT)
Methylation-Dependent Repression of miR-495 in LPS-Injured NR8383 Cells
It is well known that methylation of miR-495 promoter downregulates the expression of miR-495.
15
- Li Z.
- Zhang G.
- Li D.
- Jie Z.
- Chen H.
- Xiong J.
- Liu Y.
- Cao Y.
- Jiang Chiliad.
- Le Z.
- Tan Due south.
Methylation-associated silencing of miR-495 inhibit the migration and invasion of human being gastric cancer cells by straight targeting PRL-3.
- Crossref
- PubMed
- Scopus (38)
- Google Scholar
Thus, in guild to further verify the role of miR-495 promoter methylation in the expression of miR-495 in LPS-induced ALI, we predicted the cytosine-phosphate-guanine (CpG) island in miR-495 promoter region using the MethPrimer website (https://www.urogene.org) and appropriately designed primers to perform a methylation-specific PCR (MSP) assay. The results revealed that the miR-495 promoter region site was methylated in NR8383 cells administered LPS compared to the NR8383 cells administered F-12K civilisation medium (Figure 3A); compared with LPS-exposed NR8383 cells treated with DMSO, the miR-495 promoter region site was found to exist unmethylated in LPS-exposed NR8383 cells treated with 5-Aza (Figure 3B). Additionally, a chromatin immunoprecipitation (Flake) assay was performed in order to test the enrichment of Dna methyltransferase one (DNMT1) and Dna methyltransferase 3a/b (DNMT3a/b) in the miR-495 promoter region, which revealed that the enrichment of DNMT1 and DNMT3a/b in the miR-495 promoter region was increased in the NR8383 cells exposed to LPS when compared to the NR8383 cells incubated with F-12K civilisation medium (p < 0.05) merely was decreased in LPS-exposed NR8383 cells treated with 5-Aza relative to the LPS-exposed NR8383 cells treated with DMSO (p < 0.05) (Figure 3C). As suggested by qRT-PCR, the expression of miR-495 was noted to exist reduced in LPS-treated NR8383 cells when compared with that in F-12K civilization-medium-treated NR8383 cells (p < 0.05); when compared to the delivery of DMSO, the delivery of 5-Aza was found to elevate the expression of miR-495 in LPS-exposed NR8383 cells (p < 0.05) (Figure 3D). As detected by methylated DNA immunoprecipitation (MeDIP) assay, miR-495 promoter methylation levels in NR8383 cells manipulated with LPS were elevated compared to NR8383 cells manipulated with F-12K culture medium (p < 0.05); in comparing with DMSO treatment, treatment of 5-Aza resulted in reduced methylation levels of the miR-495 promoter in LPS-exposed NR8383 cells (p < 0.05) (Figure 3E). Taken together, the aforementioned results demonstrated that LPS induction increases methylation of miR-495 promoter and leads to the downregulation of miR-495 in LPS-induced ALI.
Figure iii Expression of miR-495 Is Reduced in LPS-Exposed NR8383 Cells due to the Methylation of miR-495 Promoter
Show total caption
(A) CpG island in the miR-495 cistron promoter region predicted using the MethPrimer website. (B) Methylation of the miR-495 promoter in NR8383 cells treated with F-12K culture medium, LPS, combined LPS and DMSO, or combined LPS and 5-Aza equally measured by MSP assay. (C) Enrichment of DNMT1 and DNMT3a/b in the miR-495 promoter region in NR8383 cells treated with F-12K culture medium, LPS, combined LPS and DMSO, or combined LPS and 5-Aza as measured by Scrap assay. (D) Expression of miR-495 in NR8383 cells treated with F-12K culture medium, LPS, combined LPS and DMSO, or combined LPS and 5-Aza as determined by qRT-PCR. (East) Methylation of miR-495 promoter in NR8383 cells treated with F-12K culture medium, LPS, combined LPS and DMSO, or combined LPS and 5-Aza detected by MeDIP assay. *p < 0.05 versus NR8383 cells treated with F-12K culture medium; #p < 0.05 versus NR8383 cells treated with LPS and DMSO. Measurement data were expressed equally hateful ± SD, and data amid multiple groups were compared using ane-way ANOVA and subjected to Tukey's postal service hoc examination. The experiment was repeated 3 times to obtain the hateful value.
- View Big Prototype
- Figure Viewer
- Download Hi-res image
- Download (PPT)
Restoring miR-495 Inhibits NLRP3 and Blocks LPS-Induced Inflammasome Activation
In the following experiments, we explored the effects of miR-495 on NLRP3 inflammasome activation by altering the expression of miR-495 with miR-495 mimic in NR8383 cells in LPS-induced injury models. qRT-PCR was performed to quantify miR-495 in NR8383 cells, and nosotros constitute that LPS handling downregulated the expression of miR-495 equally the F-12K culture medium treatment for control (p < 0.05). In addition, compared with transfection with mimic NC, miR-495 mimic transfection was found to lead to restored expression of miR-495 in LPS-exposed NR8383 cells (p < 0.05) (Figure 4A). Next, the protein expression levels of NLRP3, ASC, and caspase-ane in NR8383 cells were measured using western blot analysis, whose findings revealed that LPS-exposed NR8383 cells presented with upregulated expression levels of NLRP3, ASC, and caspase-1 compared to NR8383 cells receiving F-12K culture medium (p < 0.05), which was opposite to the trends observed in the LPS-exposed NR8383 cells after transfection with miR-495 mimic (p < 0.05) (Effigy 4B). Moreover, it was found that LPS treatment could drag the expression levels of IL-1β, IL-18, and Cle-GSDMD when compared with the F-12K civilization medium treatment (p < 0.05), whereas transfection with miR-495 mimic resulted in a decline in the expression levels of IL-1β, IL-eighteen, and Cle-GSDMD in the LPS-exposed NR8383 cells (p < 0.05) (Effigy 4C). As detected past ELISA, the levels of proinflammatory factors (TNF-α, IL-6, IL-1β, and IL-18) and anti-inflammatory factor IL-10 were noted to be elevated in response to LPS commitment (p < 0.05). However, the levels of pro-inflammatory factors were downregulated, and those of the anti-inflammatory factor were upregulated in LPS-exposed NR8383 cells post-obit transfection with miR-495 mimic (p < 0.05) (Effigy 4D). From these results, it could be inferred that upregulation of miR-495 could suppress the NLRP3 inflammasome activation in ALI.
Figure 4 Activation of NLRP3 Inflammasome Triggered LPS Is Adulterate by Superlative of miR-495
Show full caption
(A) Expression of miR-495 in NR8383 cells treated with LPS, F-12K civilisation medium, combined LPS and mimic NC, or combined LPS and miR-495 mimic as detected by qRT-PCR. (B) Expression levels of NLRP3, ASC, and caspase-1 in NR8383 cells treated with LPS, F-12K culture medium, combined LPS and mimic NC, or combined LPS and miR-495 mimic as detected by western blot analysis. (C) Expression levels of IL-1β, IL-18, and Cle-GSDMD in NR8383 cells treated with LPS, F-12K culture medium, combined LPS and mimic NC, or combined LPS and miR-495 mimic as detected by western absorb analysis. (D) Expression levels of proinflammatory factors (TNF-α, IL-half-dozen, IL-1β, and IL-18) and anti-inflammatory factor IL-ten in NR8383 cells treated with LPS, F-12K civilization medium, combined LPS and mimic NC, or combined LPS and miR-495 mimic as detected by ELISA. *p < 0.05 versus NR8383 cells treated with F-12K culture medium; #p < 0.05 versus NR8383 cells treated with both LPS and mimic NC. Measurement data were expressed as mean ± SD, and data amid multiple groups were compared using one-manner ANOVA and subjected to Tukey's post hoc test. The experiment was repeated iii times to obtain the hateful value.
- View Large Paradigm
- Figure Viewer
- Download Hello-res image
- Download (PPT)
Restoring miR-495 Reduces LPS-Induced Pyroptosis of Alveolar Macrophages
After demonstration of the effect of miR-495 on the activation of the NLRP3 inflammasome in ALI, the focus of the experiment shifted to elucidating the role of miR-495 in the pyroptosis of alveolar macrophages. Equally detected by menses cytometry, the pyroptosis of NR8383 cells was noted to be promoted in response to LPS treatment compared with F-12K culture medium treatment; transfection with miR-495 mimic attenuated the pyroptosis of LPS-exposed NR8383 cells (p < 0.05) (Figure 5A). Pyroptosis was further measured using the propidium iodide (PI)/Hoechst 33342 double-staining method, which revealed that pyroptosis of NR8383 cells was enhanced following LPS delivery versus the delivery of F-12K culture medium; LPS-exposed NR8383 cells exhibited attenuated pyroptosis in response to transfection with miR-495 mimic (p < 0.05) (Effigy 5B). To summarize, the aforementioned findings suggested that miR-495 elevation could inhibit pyroptosis of alveolar macrophages.
Figure five Pyroptosis of Alveolar Macrophages Triggered by LPS Is Attenuated with the Elevation of miR-495
Bear witness full caption
(A) Pyroptosis of LPS-exposed NR8383 cells determined by flow cytometry. (B) Pyroptosis of LPS-exposed NR8383 cells determined by PI/Hoechst 33342 double staining (200×). *p < 0.05, versus NR8383 cells treated with F-12K civilization medium; #p < 0.05, versus LPS-exposed NR8383 cells transfected with mimic NC. Measurement data were expressed equally mean ± SD, and data among multiple groups were compared using one-way ANOVA and subjected to Tukey'southward postal service hoc test. The experiment was repeated three times to obtain the mean value.
- View Large Prototype
- Figure Viewer
- Download Hi-res image
- Download (PPT)
Restoring miR-495 Downregulates NLRP3 to Suppress LPS-Induced Inflammation and Pyroptosis In Vitro
Advertisement, we performed a serial of assays to make up one's mind how miR-495 influences the LPS-induced injury in vitro by regulating the expression of NLRP3. LPS-exposed NR8383 cells were transfected with miR-495 mimic or co-transfected with both miR-495 mimic and oe-NLRP3 (NLRP3 overexpression plasmid) or their corresponding controls (mimic NC or oe-NC). The expression of miR-495 in NR8383 cells was measured using qRT-PCR, which revealed that NR8383 cells treated with LPS presented with reduced expression of miR-495 compared with NR8383 cells treated with F-12K civilisation medium (p < 0.05). Compared with LPS-exposed NR8383 cells transfected with mimic NC, LPS-exposed NR8383 cells transfected with miR-495 mimic exhibited increased expression of miR-495 (p < 0.05). Withal, compared with LPS-exposed NR8383 cells co-transfected with miR-495 mimic and oe-NC, there were no pregnant differences in the expression of miR-495 in LPS-exposed NR8383 cells co-transfected with miR-495 mimic and oe-NLRP3 (p > 0.05) (Effigy 6A). Moreover, the expression levels of NLRP3, IL-1β, IL-18, ASC, and caspase-1 were measured using western blot assay, and information technology was found that LPS-treated NR8383 cells presented with increased expression levels of these factors relative to the NR8383 cells treated with F-12K culture medium (p < 0.05). Transfection of miR-495 mimic was noted to downregulate the expression levels of NLRP3, ASC, caspase-1, IL-1β, and IL-18 in LPS-exposed NR8383 cells (p < 0.05), which were rescued by additional transfection with oe-NLRP3 (p < 0.05) (Figures 6B and 6C). As adamant past ELISA, the levels of proinflammatory factors (TNF-α, IL-6, IL-1β, and IL-18) and anti-inflammatory gene IL-10 were found to be elevated in NR8383 cells administered handling with LPS versus in NR8383 cells administered treatment with F-12K culture medium (p < 0.05). Relative to mimic NC transfection, miR-495 mimic transfection reduced the levels of pro-inflammatory factors and elevated those of the anti-inflammatory gene in LPS-exposed NR8383 cells (p < 0.05); however, transfection of oe-NLRP3 reversed the regulatory effects of miR-495 mimic on the same inflammatory factors (p < 0.05) (Figure 6D). Based on the same results, it could be concluded that elevated miR-495 attenuates LPS-induced inflammation and pyroptosis past negatively regulating NLRP3.
Effigy 6 Elevated Expression of miR-495 Depletes the Expression of NLRP3, Thus Hindering the LPS-Induced Inflammation In Vitro
Show full caption
(A) Expression of miR-495 in LPS-exposed NR8383 cells in response to transfection with plasmids including mimic NC, miR-495 mimic, oe-NC, and oe-NLRP3, every bit determined by qRT-PCR. (B) Expression levels of NLRP3, ASC, and caspase-1 in NR8383 cells in response to transfection with plasmids including mimic NC, miR-495 mimic, oe-NC, and oe-NLRP3, as adamant past western blot analysis. (C) Expression levels of Fifty-1β and IL-18 in NR8383 cells in response to transfection with plasmids including mimic NC, miR-495 mimic, oe-NC, and oe-NLRP3, as determined by western blot analysis. (D) Expression levels of proinflammatory factors (TNF-α, IL-half dozen, IL-1β, and IL-18) and anti-inflammatory gene IL-ten in NR8383 cells in response to transfection with plasmids including mimic NC, miR-495 mimic, oe-NC, and oe-NLRP3, as determined by ELISA. *p < 0.05 versus NR8383 cells treated with F-12K culture medium; #p < 0.05, versus LPS-exposed NR8383 cells transfected with mimic NC; &p < 0.05 versus LPS-exposed NR8383 cells co-transfected with miR-495 mimic and oe-NC. Measurement information were expressed as mean ± SD, and data among multiple groups were compared using one-way ANOVA and subjected to Tukey's post hoc test. The experiment was repeated three times to obtain the hateful value.
- View Large Image
- Figure Viewer
- Download Hi-res image
- Download (PPT)
Restoring miR-495 Downregulates NLRP3 to Suppress the Development of ALI In Vivo
After uncovering the role of miR-495 in LPS-induced injury in vitro, we focused on investigating the office of miR-495 in the development of LPS-induced ALI in vivo. Every bit measured past qRT-PCR, the expression of miR-495 was found to be reduced in LPS-administered rats compared with those administered normal saline (p < 0.05). The delivery of miR-495 agomir led to increased expression of miR-495 in LPS-treated rats relative to the delivery of NC agomir (p < 0.05) (Figure 7A). Moreover, the expression of NLRP3 in rat lung tissues was evaluated by western blot analysis and immunohistochemistry. The results demonstrated that the expression levels of NLRP3, ASC, and caspase-1 were college in lung tissues of normal saline-treated rats than in lung tissues of LPS-treated rats (p < 0.05). The assistants of miR-495 agomir led to reduced expression levels of NLRP3, ASC, and caspase-i in LPS-treated rats (p < 0.05) (Figures 7B and 7C). In improver, pathological changes in the lung tissues were observed and detected using H&E staining. The results revealed that, in normal saline-treated rats, the lung tissues presented with complete structure, and a few macrophages could be observed within the alveolar infinite under the microscope. In comparison with the rats treated with normal saline, LPS-treated rats exhibited largely destroyed alveolar structure, accompanied with bleeding, massive neutrophil infiltration, thickened alveolar septa, and increased lung injury scores (p < 0.05). In contrast to the rats receiving both LPS and NC agomir, the injury of lung tissues in rats receiving both LPS and miR-495 agomir was greatly reduced, and lung injury scores were decreased (p < 0.05) (Figure 7D). Further, myeloperoxidase (MPO) activity was measured to appraise neutrophil infiltration in lung tissues, which revealed that the MPO action was increased in LPS-administered rats compared to the MPO activeness normal saline-administered rats (p < 0.05), which was reduced past the delivery of miR-495 agomir in LPS-administered rats (p < 0.05) (Figure 7E). Furthermore, permeability of the lung tissues was assessed past testing the lung moisture weight (Due west)/dry out weight (D) ratio and protein content in bronchoalveolar fluid (BALF). The finding indicated that the lung W/D ratio and poly peptide content in BALF were elevated post-obit LPS treatment versus normal saline treatment (p < 0.05), both of which were reduced by the delivery of miR-495 agomir in LPS-administered rats (p < 0.05) (Figures 7F and 7G). Every bit adamant by ELISA, the levels of proinflammatory factors (TNF-α, IL-6, and IL-1β) and anti-inflammatory gene IL-10 were upregulated in response to LPS treatment versus normal saline treatment (p < 0.05); the expression levels of proinflammatory factors were downregulated, while that of the anti-inflammatory cistron was upregulated post-obit combined LPS and miR-495 agomir when in contrast to combined LPS and NC agomir (p < 0.05) (Figure 7H). All in all, the aforementioned results suggested that LPS could successfully induce ALI in rats and that increased miR-495 could hinder the evolution of ALI in vivo by negatively modulating the expression of NLRP3.
Figure 7 Elevated Expression of miR-495 Depletes the Expression of NLRP3, Thus Protecting against ALI In Vivo
Show full caption
Rats were treated with normal saline or LPS, and LPS-treated rats were further introduced with NC agomir or miR-495 agomir. (A) Expression of miR-495 in lung tissues of rats as determined by qRT-PCR. (B) Expression levels of NLRP3, ASC, and caspase-i in lung tissues of rats measured using western blot assay. (C) Immunohistochemistry detection of NLRP3 contents in rat lung tissues (400×). (D) Pathological changes of lung tissues in rats observed using H&E staining (400×). (Eastward) MPO activity in lung tissues of rats. (F) Detection of lung Westward/D ratio in rats. (G) Total protein content in BALF in rats. (H) Levels of proinflammatory factors (TNF-α, IL-vi, and IL-1β) and anti-inflammatory factor IL-10 in the BALF of rats detected past ELISA. *p < 0.05 versus rats treated with normal saline; #p < 0.05 versus rats treated with LPS and NC agomir. Measurement data were expressed as mean ± SD, and data among multiple groups were compared using one-way ANOVA and subjected to Tukey'due south mail service hoc test. The experiment was repeated iii times to obtain the mean value.
- View Large Image
- Effigy Viewer
- Download Hi-res paradigm
- Download (PPT)
Discussion
ALI is a astringent lung disease that is usually accompanied by acute inflammatory responses, resulting in failure of the respiratory organization.
16
- Leung Westward.Due south.
- Yang M.50.
- Lee S.South.
- Kuo C.W.
- Ho Y.C.
- Huang-Liu R.
- Lin H.Westward.
- Kuan Y.H.
Protective upshot of zerumbone reduces lipopolysaccharide-induced astute lung injury via antioxidative enzymes and Nrf2/HO-1 pathway.
- Crossref
- PubMed
- Scopus (34)
- Google Scholar
Despite tremendous efforts and research, ALI notwithstanding presents with tremendous fatality and morbidity rates.
Therefore, further studies focusing on novel and constructive targets of ALI are needed to provide more than insight into the management and handling of ALI. The nowadays written report aimed to investigate the potential function of miR-495 in LPS-induced ALI. Our findings evidenced that overexpression of miR-495 could repress NLRP3 inflammasome activation to ultimately inhibit the development of LPS-induced ALI.
The present written report revealed that the NLRP3 inflammasome was activated in LPS-induced ALI, while the expression of miR-495 was downregulated every bit a result of methylation of the miR-495 gene promoter. Numerous findings have indicated the interest of the NLRP3 inflammasome in the inflammatory responses of ALI and suggested that its inhibition could outcome in the alleviation of ALI.
,
In add-on, Zhang et al.
20
- Zhang Y.
- Li X.
- Grailer J.J.
- Wang North.
- Wang M.
- Yao J.
- Zhong R.
- Gao G.F.
- Ward P.A.
- Tan D.X.
- Li Ten.
Melatonin alleviates astute lung injury through inhibiting the NLRP3 inflammasome.
- Crossref
- PubMed
- Scopus (147)
- Google Scholar
reported the activation of the NLRP3 inflammasome in LPS-induced ALI, accompanied by elevated expression levels of IL-1β and caspase-ane, which is in accordance with our findings. Moreover, as illustrated by both Tian et al.
and Liu et al.,
22
- Liu Q.
- Ci X.
- Wen Z.
- Peng L.
Diosmetin alleviates lipopolysaccharide-induced acute lung injury through activating the nrf2 pathway and inhibiting the nlrp3 inflammasome.
- Crossref
- PubMed
- Scopus (42)
- Google Scholar
NLRP3 inflammasome expression was downregulated in ALI in response to LPS handling, and the inactivation of the NLRP3 inflammasome could contribute to the alleviation of LPS-induced ALI. IL-10, a member of the IL-10 cytokine family with numerous immunosuppressive effects, could be generated by various leukocyte subpopulations and is regulated past many signaling pathway and transcriptional networks.
The IL-x family is known to convalesce inflammatory response, improve innate immunity, and potentiate repairing mechanisms of tissues, thus maintaining tissue homeostasis in response to inflammation and infection.
Similar to the present study, Ernst et al.
25
- Ernst O.
- Glucksam-Galnoy Y.
- Athamna M.
- Ben-Dror I.
- Ben-Arosh H.
- Levy-Rimler G.
- Fraser I.D.C.
- Zor T.
The camp pathway amplifies early on myd88-dependent and blazon i interferon-contained lps-induced interleukin-x expression in mouse macrophages.
- Crossref
- PubMed
- Scopus (6)
- Google Scholar
and Barrett et al.
26
- Barrett J.P.
- Henry R.J.
- Villapol S.
- Stoica B.A.
- Kumar A.
- Burns M.P.
- Faden A.I.
- Loane D.J.
NOX2 deficiency alters macrophage phenotype through an IL-10/STAT3 dependent mechanism: implications for traumatic encephalon injury.
- Crossref
- PubMed
- Scopus (40)
- Google Scholar
noted upregulated levels of IL-x expression following LPS stimulation. Furthermore, NLRP3 depletion was previously revealed to result in IL-10 elevation in preeclampsia,
27
- Liu Z.
- Zhao Ten.
- Shan H.
- Gao H.
- Wang P.
microRNA-520c-3p suppresses NLRP3 inflammasome activation and inflammatory cascade in preeclampsia by downregulating NLRP3.
- Crossref
- PubMed
- Scopus (20)
- Google Scholar
which was in line with our results. Zhu et al.,
28
- Zhu W.D.
- Xu J.
- Zhang M.
- Zhu T.G.
- Zhang Y.H.
- Sun One thousand.
MicroRNA-21 inhibits lipopolysaccharide-induced astute lung injury past targeting nuclear factor-κB.
- PubMed
- Google Scholar
plant that LPS treatment led to a downregulated level of IL-x in rats with LPS-induced ALI, which was opposite to our finding, the increase of IL-x was both determined in the cell and rat models later on LPS stimulation. In improver, Deoxyribonucleic acid methylation, an essential component of epigenetic modification, plays a crucial role in mediating multiple cellular processes past modulating cistron expression,
29
- Chen Y.
- Shi J.X.
- Pan 10.F.
- Feng J.
- Zhao H.
Deoxyribonucleic acid microarray-based screening of differentially expressed genes related to astute lung injury and functional assay.
- PubMed
- Google Scholar
and hypermethylation of the miRNA factor promoter is constantly associated with the downregulation of miRNA.
30
- He X.X.
- Kuang S.Z.
- Liao J.Z.
- Xu C.R.
- Chang Y.
- Wu Y.L.
- Gong J.
- Tian D.A.
- Guo A.Y.
- Lin J.S.
The regulation of microRNA expression by DNA methylation in hepatocellular carcinoma.
- Crossref
- PubMed
- Google Scholar
,
Matt et al.
32
- Matt South.Chiliad.
- Zimmerman J.D.
- Lawson M.A.
- Bustamante A.C.
- Uddin Yard.
- Johnson R.Due west.
Inhibition of DNA methylation with zebularine alters lipopolysaccharide-induced sickness behavior and neuroinflammation in mice.
- Crossref
- PubMed
- Scopus (9)
- Google Scholar
found that reduction of Dna methylation by zebularine could alleviate sickness and inflammation induced by LPS stimulation in the brain of mice. Furthermore, a previous study correlated aberrant methylation of genes in lungs with pathological and physiological processes of LPS-induced ALI.
33
- Zhang 10.Q.
- Lv C.J.
- Liu X.Y.
- Hao D.
- Qin J.
- Tian H.H.
- Li Y.
- Wang X.Z.
Genome-broad assay of DNA methylation in rat lungs with lipopolysaccharide-induced acute lung injury.
- Crossref
- PubMed
- Scopus (twenty)
- Google Scholar
In line with our findings, Li et al.
15
- Li Z.
- Zhang Yard.
- Li D.
- Jie Z.
- Chen H.
- Xiong J.
- Liu Y.
- Cao Y.
- Jiang M.
- Le Z.
- Tan South.
Methylation-associated silencing of miR-495 inhibit the migration and invasion of homo gastric cancer cells past directly targeting PRL-3.
- Crossref
- PubMed
- Scopus (38)
- Google Scholar
,
34
- Chen Y.
- Luo D.
- Tian W.
- Li Z.
- Zhang X.
Demethylation of miR-495 inhibits cell proliferation, migration and promotes apoptosis by targeting STAT-iii in breast cancer.
- Crossref
- PubMed
- Scopus (27)
- Google Scholar
demonstrated that miR-495 promoter methylation could pb to the depletion of miR-495 in both gastric and breast cancers. In improver, downregulated expression of miR-495 was plant in non-pocket-sized-jail cell lung cancer cells and served equally a tumor suppressor of this cancer.
35
- Chu H.
- Chen X.
- Wang H.
- Du Y.
- Wang Y.
- Zang W.
- Li P.
- Li J.
- Chang J.
- Zhao G.
- Zhang Thou.
MiR-495 regulates proliferation and migration in NSCLC past targeting MTA3.
- Crossref
- PubMed
- Scopus (49)
- Google Scholar
As expected, we uncovered that elevated miR-495 negatively regulates the NLRP3 gene to suppress NLRP3 inflammasome activation and alleviate alveolar macrophage inflammation in LPS-induced ALI. Consistently, accumulating evidence has indicated that NLRP3 is the target of miR-223, which inhibits activation of the NLRP3 inflammasome.
36
- Haneklaus Yard.
- Gerlic M.
- Kurowska-Stolarska Thou.
- Rainey A.A.
- Pich D.
- McInnes I.B.
- Hammerschmidt West.
- O'Neill 50.A.
- Masters Due south.L.
Cutting edge: miR-223 and EBV miR-BART15 regulate the NLRP3 inflammasome and IL-1β product.
- Crossref
- PubMed
- Scopus (310)
- Google Scholar
,
As well, Zhou et al.
38
- Zhou T.
- Xiang D.Grand.
- Li S.N.
- Yang L.H.
- Gao L.F.
- Feng C.
Microrna-495 ameliorates cardiac microvascular endothelial prison cell injury and inflammatory reaction by suppressing the nlrp3 inflammasome signaling pathway.
- Crossref
- PubMed
- Scopus (34)
- Google Scholar
demonstrated that miR-495 could negatively regulate expression of the NLRP3 inflammasome signaling pathway to attenuate injury and inflammation in cardiac microvascular endothelial cells. Additionally, peak of miR-495 also contributed to decreased inflammation caused by high glucose content in cardiac fibrosis.
39
- Wang X.
- Jin H.
- Jiang Southward.
- Xu Y.
MicroRNA-495 inhibits the loftier glucose-induced inflammation, differentiation and extracellular matrix accumulation of cardiac fibroblasts through downregulation of NOD1.
- Crossref
- PubMed
- Scopus (22)
- Google Scholar
Furthermore, some other study demonstrated that the levels of proinflammatory factors (TNF-α, IL-6, and IL-1β) in alveolar macrophages were downregulated in the presence of miR-146a, suggesting that elevation of miR-146a alleviates the inflammatory response in LPS-induced ALI and could function as a promising target to prevent LPS-induced ALI.
xl
- Zeng Z.
- Gong H.
- Li Y.
- Jie K.
- Ding C.
- Shao Q.
- Liu F.
- Zhan Y.
- Nie C.
- Zhu Westward.
- Qian One thousand.
Upregulation of miR-146a contributes to the suppression of inflammatory responses in LPS-induced acute lung injury.
- Crossref
- PubMed
- Scopus (109)
- Google Scholar
Moreover, the activation of NLRP3 inflammasome in alveolar macrophages was previously establish to cause lung inflammation and injury induced by mechanical stretch, thus proposing NLRP3 as an underlying biomarker for treating ventilator-induced lung injury,
41
- Wu J.
- Yan Z.
- Schwartz D.Due east.
- Yu J.
- Malik A.B.
- Hu G.
Activation of NLRP3 inflammasome in alveolar macrophages contributes to mechanical stretch-induced lung inflammation and injury.
- Crossref
- PubMed
- Scopus (168)
- Google Scholar
which was identical to our results. Additionally, morin administration inhibited NLRP3 inflammasome activation, further protecting against LPS-induced ALI, accompanied past a reduced number of inflammatory cells in the BALF, downregulated expression of NLRP3 inflammasome, and adulterate MPO activity.
In summary, the present study uncovered that methylation of the miR-495 promoter could downregulate the expression of miR-495 and that overexpression of miR-495 could inhibit the development of ALI past negatively regulating the NLRP3 factor, suggesting that upregulated miR-495 and downregulated NLRP3 could serve every bit promising therapeutic targets for the direction of ALI. Moreover, the present study provides insights and a deeper understanding of the underlying mechanisms of ALI. However, further efforts are needed to confirm the efficacy of these biomarkers and targets in early detection, prediction, and prevention of lung injuries and diseases. Also, more research is warranted to elucidate the underlying mechanisms by which LPS activates DNMTs interacting with the miR-495 promoter in hereafter studies.
Materials and Methods
Ethics Statement
All experimental protocols for the nowadays written report were approved by the Experimental Creature Ethics Committee of Shanghai 9th People's Hospital, Shanghai Jiao Tong University School of Medicine. All animal experimentation strictly adhered to the principles to minimize the number, pain, suffering, and discomfort of the experimental animals.
Cell Civilisation and Treatment
Rat alveolar macrophages (NR8383 cells) purchased from the American Type Culture Drove (Manassas, VA, Usa) were cultured in Ham's F-12K complete medium (Thermo Fisher Scientific, Waltham, MA, USA) containing ane.5 g/L sodium bicarbonate, fifteen% fetal bovine serum, and ii nM L-glutamine at 37°C with v% CO2 in air. With the prison cell concentration adjusted to 4 × 10v cells per milliliter, the cells were added to a 96-well plate with 100 μL cells per well. Cells were continually cultured for eighteen h with the add-on of F-12K culture medium or LPS (final concentration, 1 μg/mL), and LPS-induced cell-injury models were established. Plasmids including mimic NC, miR-495 mimic, sh-NC, sh-NLRP3, oe-NC, and oe-NLRP3 were purchased from GenePharma (Shanghai, China) and were delivered into the LPS-administered cells according to the instructions for Lipofectamine 2000 (Invitrogen, Carlsbad, CA, U.s.a.).
43
- Zheng H.East.
- Wang G.
- Song J.
- Liu Y.
- Li Y.G.
- Du Due west.P.
MicroRNA-495 inhibits the progression of non-small-cell lung cancer by targeting TCF4 and inactivating Wnt/β-catenin pathway.
- PubMed
- Google Scholar
Subsequently, the cells were treated with DMSO or 5-Aza (Sigma-Aldrich Chemical, St Louis, MO, United states).
Establishment of Rat Model of LPS-Induced ALI
Specific pathogen-free Sprague-Dawley rats (aged 8 weeks, weighing 200–250 g) were purchased from Hunan SJA Laboratory Animal (Changsha, Hunan, China). The rats were reared individually in a sterile surround with abiding temperature (22°C), 50% relative humidity, and 12-h:12-h light/night bike. LPS (five mg/kg) was instilled into the tracheas of the anesthetized rats to induce ALI.
44
- Zhang Q.
- Nie J.
- Chen Due south.J.
- Li Q.
Protective effects of ethyl gallate and pentagalloylglucose, the active components of Qingwen Baidu Decoction, against lipopolysaccharide-induced acute lung injury in rats.
- Crossref
- PubMed
- Scopus (3)
- Google Scholar
Afterwards, the rats were treated with normal saline or 5 mg/kg LPS. Rats administered with v mg/kg LPS were further manipulated with NC agomir or miR-495 agomir, which were both synthesized by Guangzhou RiboBio (Guangzhou, Guangdong, China). After 12 h of LPS handling, all rats were euthanized, and the specimens were collected for further experimentation.
Western Blot Analysis
Cells were detached with trypsin and lysed using intensified radioimmunoprecipitation assay (RIPA) lysis buffer (Boster Biological Technology, Wuhan, Hubei, China) conjugated with a protease inhibitor. After, the poly peptide concentration was measured using bicinchoninic acid (BCA) poly peptide assay kits (Boster Biological Technology, Wuhan, Hubei, China). Later protein separation using x% SDS-Page, the proteins were transferred onto a polyvinylidene fluoride membrane, which was sealed with 5% BSA for two h. The membrane was then incubated overnight at 4°C with the improver of the following diluted main antibodies: rabbit antibody to NLRP3 (ab214185, dilution ratio of 1:i,000), rabbit antibiotic to caspase-1 (ab62698, dilution ratio of one:1,000), rabbit antibiotic to ASC (ab18193, dilution ratio of one:1,000), IL-1β (ab200478, dilution ratio of 1:500), rabbit antibody to IL-18 (ab71495, dilution ratio of 1:300), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; ab181602, dilution ratio of ane:5,000). All aforementioned antibodies were purchased from Abcam (Cambridge, Great britain). Subsequently, the membrane was rinsed with PBS/Tween (PBST) iii times and further incubated with horseradish peroxidase (HRP)-labeled secondary antibody of caprine animal anti-rabbit (ab205719; dilution ratio of 1:two,000; Abcam, Cambridge, UK) at room temperature for 1 h, followed by development using enhanced chemiluminescence (ECL; Millipore, Bedford, MA, The states). The ImageJ software was used for quantification of the protein bands, with GAPDH serving every bit the internal control.
ELISA
Prison cell-culture medium in each well was centrifuged to collect the jail cell supernatant. According to the instructions of the ELISA kits, the levels of TNF-α (LC2062), IL-6 (JLC1236), IL-xviii (JLC1702), IL-1β (JLC1704), IL-10 (JLC1689), and caspase-ane (JLC1702)—which were all provided by Shanghai Jingkang Bioengineering (Shanghai, Communist china)—in the cell supernatant and alveolus lavage fluid were measured.
Dual-Luciferase Reporter Gene Analysis
The interaction between miR-495 and NLRP3 was analyzed using the bioinformatic website http://www.microrna.org/microrna/home.do. Based on the findings of the predicted binding site, the synthesized NLRP3 mRNA iii′ UTR sequence and its mutant sequence were inserted into the pmirGLO vector (E1330; Promega, Madison, WI, USA) to generate NLRP3-WT and NLRP3-Mut reporter plasmids. The sequences are shown in Table one. Next, NLRP3-WT and NLRP3-Mut reporter plasmids with correct sequences were co-transfected with miR-495 mimic or mimic NC into HEK-239T cells. Later on 48 h of culture, the luciferase activity in cells was detected based on the manufacturer's protocols for dual-luciferase reporter gene assay kits (D0010, Beijing Solarbio Science and Technology, Beijing, People's republic of china) provided by Genecopoeia (Rockville, MD, United states). Luminance was measured using the Glomax20/twenty luminometer (E5311, Shaanxi Zhongmei Biotechnology, Xian, Shaanxi, Mainland china) provided by Promega (Madison, WI, USA).
Tabular array 1 The Sequences of NLRP3-WT, NLRP3-Mut, and miR-495 Promoter for Dual-Luciferase Reporter Assay
| Factor names | Sequence |
|---|---|
| NLRP3-WT | GCGTGGAAGCAGGACCACCAGGTGCCTCGGTCCTGCCCCAAGTCCTGCCCCAAGCCCCAGTGCGCACTGCTCTTCACTGCTATCAAGCCCTCCTTCACCATCAGGATCACAGCCGAGGCTCTTCTGGTATAGGGTCTGGAGCAAAGGCTTGTGTGGGACCAAATATTTTTCCTCACATCGATAACGTGAAACTGCCAGAGGCTGCCCTTCCCATCATATCCTCAGTGGGCAAGGTGTTCCCTCTTGGTGACTTCATGGAAACAGCTTCAAGAAAACGCCTTTTCTGTCCTCCCCCGCCCTCCTCTTACTCCTGCCCCTCCTCCTCCTCCTCCTCCCCTCCCCCCCCCTCCTCCTCCGCTTCTCCCCCCACCTGTCTTTCTCTCTCTGGGCCTCTGGTTTTTTGACCTTTGCCCATACCTTCAGTCTTGTCTTCCTGTTAACTGACCATCCCGCATAAGGAGCTGCCCGTGGGCTAGATGGAAGGTTTGTGGCAGCCTCTCAGCTACATTGTTTGTTTTTATTTTTTAATAGTTATGATTTCTCTTTAGCTACCTGAAAACTCAGAGATTTATAAAACCCATTTTTGTATTTATTGTATGTTTGTACTGCTTTCTTAATTTAAAAATGTATCTAGAATTCTTTTAAGTTATTTATCCAAACTACTAAAAATAAATCAGTTTACACATTTAAAA |
| NLRP3-Mut | GCGTGGAAGCAGGACCACCAGGTGCCTCGGTCCTGCCCCAAGTCCTGCCCCAAGCCCCAGTGCGCACTGCTCTTCACTGCTATCAAGCCCTCCTTCACCATCAGGATCACAGCCGAGGCTCTTCTGGTATAGGGTCTGGAGCAAAGGCTTGTGTGGGACCAAATATTTTTCCTCACATCGATAACGTGAAACTGCCAGAGGCTGCCCTTCCCATCATATCCTCAGTGGGCAAGGTGTTCCCTCTTGGTGACTTCATGGAAACAGCTTCAAGAAAACGCCTTTTCTGTCCTCCCCCGCCCTCCTCTTACTCCTGCCCCTCCTCCTCCTCCTCCTCCCCTCCCCCCCCCTCCTCCTCCGCTTCTCCCCCCACCTGTCTTTCTCTCTCTGGGCCTCTGGTTTTTTGACCTTTGCCCATACCTTCAGTCTTGTCTTCCTGTTAACTGACCATCCCGCATAAGGAGCTGCCCGTGGGCTAGATGGAAGGTTTGTGGCAGCCTCTCAGCGCACGGCGGGCGGGTTATTTTTTAATAGTTATGATTTCTCTTTAGCTACCTGAAAACTCAGAGATTTATAAAACCCATTTTTGTATTTATTGTATGTTTGTACTGCTTTCTTAATTTAAAAATGTATCTAGAATTCTTTTAAGTTATTTATCCAAACTACTAAAAATAAATCAGTTTACACATTTAAAA |
| miR-495 Promoter | ACTCAGAATCCAGCCGCTTCGTGGGCAGCGTTCAGTCCATGCTTGGGGAAAGGGCTTTGT |
| TGCCGTTGCTCATCTCTGTCTGTTGTTCAGCTCTGCTTGCCTTACGAGGCCCCAGATGCC | |
| CTGGATGCCCTCAGTGTCAGACTGCGGAAGATGTGTCCCGGCTGTGACACGCGCTTCAGG | |
| GGAGGGCTGTTGGCGTCAGGTCCATGGAGAGGTATGGGAGTGGACATCTTGTCTGAGAGC | |
| AGACATTCTATTTCGGGTGTGTGTCTTGGTCCGTTCATCCTCAGTCTCCCTCCCATACCT | |
| AGGATGGCTTGTGGAGAGAAGGCCTGCCCTGAGGGCTGAAGTTGGGACCCACAGCTCTCA | |
| CCCCGGCCTTGGTATGCTCCCATGGCTACGGCAGAGGCACAAGAAAGTAATTAGAAACGC | |
| AGAAACTCCTTAAGGCCAAGGCTGGGAACTGCTATATTTCTACCCACAGATCATTGACCA | |
| GAACAATTACACGGCCGAACCCAAGGCAAGGGGCGGGGAGGCCCACTCCACCCGGGAGGG | |
| GGTTGTGGTGAGGTGTGAATGCAGGAACCGGTGAGGATTTGCCACCACCAAGTCAGTTGT | |
| CCACGTGGACCACCTGAGAACTTGGGTTTTATTCATTGCTCATTCATCCCTCCCTAACCC | |
| GCAGCTTCCGGTCTGCCCCGGGGGCTCTTCTCCGGCTCAGGCTGATCGACAGTGGTGACG | |
| CTGTGCCAGGACCCCTGGTCATTCCATCTGTTTGAGGCAAATGTTAAAAAATCCCTTGCG | |
| CTACCCATTCTATGACGACTCCCTTGGCTCAGAGGCTCCATCAGGGCAGACACTTTGCTG | |
| TTTGTCCCTAAAGGGTGGGTGGTAGATCTCATCCATCTTATCTGGGGAGTTATTGTGACT | |
| CTCCTGGTCCCTCCTCATGTATCCTCAGGAGGACTTTTAGGATGCAAAATCACTGTTTCT | |
| GTGCCATTGTCATATTCTGTGCTACTGGAGGAGACTTTTTGTTATTGAGAAATTGAACAC | |
| ATCGTGCTCACAAGCAGCTCCAGGACACAATGCCACCTGTGCAGAGGGGGCAGACCTGTT | |
| AGATGTCTCCCAGGTCTTGAGGGGGTTGTATGCACGGCCATATCTTTGTCACCGGTTGCC | |
| CGGTGCGCATCAGGACCCATGTGCTCTCAGGAAGCCCGCAGGAGTGATACCAGCCGCGGA | |
| GAAGCAGTGTTGTCAACGGTGCTGACGTGCGGTACTTAATGAGAAGTTGCCCGTGTTTTT | |
| TTCGCTTTATTTGTGACGAAACATTCGCGGTGCACTTCTTTTTCAGTATCCTATTCTGCC | |
| TTGAAGACGTCTTGGTTTGGGTGCAACTTCAGGGAAGGCACATGGGCCCCTGTAGTGGAC | |
| GCTGATCAGGACCTCCCTACCCCATGTCTTTTCTCCTTCCTAAATTTCTCCTTGTTTTTT | |
| TTTTTTTTTTTTTTTTTTATGAAAGCTCCCGTCTTCCCGCCGTGTGCTTTGATTGCATTG | |
| ACCCTGCCCCACTTCCTCCACCAGCCCAGGCTTAAGCGAATCTCTTGATCTCTTCTCCTT | |
| TGCCACTGCAATTGCTTCCGGAATAGGCCCATGACCCCACTGGGCCAGTGATAGGCAAGG | |
| AGATGCTTGCTGCAGCTTCTGGGAAAGAAACTGTTTCTCCCTTTCCTGTGATAGCTGCCA | |
| GAGTAGACACTGTCTATTCCATTCAGCTGGGAATAGACAGTGAACTTTGACGTGAGCTTC | |
| GAAGGTCCCACAGCCGTTTAAGGACTGAGAGGAGAGGGCTTGGTGCCACGCAGACACAGC | |
| AGAGGGAGTCTGTACCATGAAAGGCATCTTGGAGACCTAGAGAAGAGCCTGGATGATATC | |
| ATTTGAGTCCCTAGATCAAACCCTGCCTGAAGCTTGCTCTGTCTCTGTACTTTTTAGTTA | |
| TATACGTCTATAAATCCCTTACTTGTTTAAGCCAGTTGGAGTTAGATCTTATCTTACTTG | |
| CAATACAAACAGATGATACCACAGTGTGTTTTCCAGTGTGACTGGGAAAGCCTGCATTTT | |
| TTTCAATGATGTGTTTCTCACGGTTTGCCTATCTATCTTCAGTGTCCTATTTAAGGCAGG | |
| GTTTTGGTGGAAGGTGACTTTTCTTATGGACTTATGCTTTCAAAGCTTTGTCTTAGTGAT | |
| TTAATTTATGGTTGACAAATGATGCACAATTACCGTGTTTTGTGTCCAGCAATGGGTCAC | |
| TGGGTCCTCTCTGGAAGGCCTGATGGATGGTGGGCCCCAGAACTTCTGCCCCGATTCACT | |
| CTCCCTCGAATCCACCTCTCTCTGGGAGGCTGCCCTGCAAGTGATGTGGACTTGGGGAAG | |
| CCGTTGTCCTTTCCTGGCCCCTGCTGTCCTTTGGCTCTCTGTGGGTTGGCTGTATTTGTC | |
| ACAACTCACACTTAACTGTCAGTGTTTTAGAACCAAGCCATGCCTCCAGGGAACCCGGAG | |
| CACTTTAGAGAGGAGGTGCAGTGGTCAGCACCATGCAAGGTGCACAGAGAGATGGGTCCA | |
| CCGAGAGCCGGGGCTGCCTTGGTGGTTTGTTTCTCCTGATTCGATATCTTTGTCTTCCCA | |
| TCTCCTTCCTGGAACCATGGGCTCATGGAGGAGATTCTATTTTTGGGTCCAGGACCATCC | |
| CATTTTCTCTGAAGTGATGCTCTCCATGAGCATTTGCAGGGTTGATAGTAAACATTCCGA | |
| AAGCCGTCTGCCCTGATTATTGAATTCTGCCCATGAAGACTTCCTGGGATCCCGAAGTAG | |
| AGGGAGTCTGGGATCGGTTTGCTTTATCCGTGATGACTGTCCGCCTCTGCTCAGTGTCAG | |
| CCCAGCCCTTCGAAGCATGTCCCCCACCTCCCCTGGGGTGAGCCAACTTACCTGATGCTT | |
| TTAGGCTTAATTGAGCATAAGTTTGATTGGCAGCGTCTGCCCGGCCCTGCCCTCACGCCC | |
| TGACCCTCAGTGTCCCTTCACGCCCAGGTGTGCCTCTGGCAGGGAGGACGTGCTCATCTC |
- Open up table in a new tab
RNA Isolation and Quantification
Full RNA was extracted using TRIzol Reagent (catalog no. 15596026, Invitrogen, Carlsbad, CA, USA) and reverse transcribed into cDNA using NCode miRNA Beginning-Strand cDNA Synthesis Kits (Thermo Fisher Scientific, Waltham, MA, The states). The synthesized cDNA was detected using Fast SYBR Green PCR Kits (Practical Biosystems, Carlsbad, CA, U.s.). The primers for qRT-PCR were synthesized by Sangon Biotech (Shanghai, Communist china), and the sequences were as follows: reverse primer: 5′-GAGACTGCGGATGTATAGAACTTGA-iii′; frontward primer: five′-AAACAAACATGGTGCACTTCTT-3′.
MSP Assay
The methylation of the miR-495 promoter region was detected using the EZ Deoxyribonucleic acid Methylation-Gold Kit (D5005, Zymo Research, Irvine, CA, USA). The primers (and sequences) for methylated reaction in MSP amplification were miR-495-Dr. (5′-TAGAGAGATGGGTTTATCGAGAGTC-3″) and miR-495-MR (5′-AGAGATGGGTTTATTGAGAGTTGG-three″), and the primers and sequences for unmethylated reaction in MSP amplification were miR-495-UD (5′-TTGGTGAAGTTGGGTG-3′) and miR-495-UR (5′-AAATTCAATAATCAAAACAAACAAC-three′). All same primers were synthesized by Sangon Biotech (Shanghai, China). Purified RNA was added to the CT conversion reagent for denaturation and bisulfate conversion. Side by side, the purified RNA was subjected to PCR. The PCR products were subjected to agarose gel electrophoresis, and the obtained images were analyzed using gel electrophoresis imaging and an image analysis organization.
xv
- Li Z.
- Zhang Thousand.
- Li D.
- Jie Z.
- Chen H.
- Xiong J.
- Liu Y.
- Cao Y.
- Jiang Thousand.
- Le Z.
- Tan S.
Methylation-associated silencing of miR-495 inhibit the migration and invasion of human gastric cancer cells by directly targeting PRL-3.
- Crossref
- PubMed
- Scopus (38)
- Google Scholar
MeDIP Analysis
MeDIP assay was carried out in accordance with the instructions of the MeDIP kits. Briefly, genomic Deoxyribonucleic acid was extracted from the cells and purified following standard procedures. Adjacent, the obtained Deoxyribonucleic acid was sheared into 200–1,000 bp fragments by ultrasonication. The Dna fragments were then denaturized at 95°C to obtain unmarried-chain Deoxyribonucleic acid fragments. After, the single-concatenation Dna fragments were co-incubated with the antibody 5-mC to obtain a Deoxyribonucleic acid-five-mC complex, which was captured by magnetic chaplet. The Dna pulled downward was purified with phenol/chloroform extraction and and then subjected to qPCR.
Chip Assay
Cells were treated with four% formaldehyde with a concluding concentration of 1%, and the collected cells were crushed ultrasonically. Antibodies to DNMT3b (ab2851, dilution ratio of 1:50, Abcam, Cambridge, UK), DNMT1 (ab13537, dilution ratio of 1:50, Abcam, Cambridge, UK), and DNMT3a (ab2850, dilution ratio of 1:50, Abcam, Cambridge, U.k.) were bound to the miR-495 gene promoter, and protein A agarose/salmon sperm DNA was bound to the factor promoter complex, which was precipitated. The precipitated complex was so rinsed to remove the non-specific binding. Subsequently, the enriched miR-495 promoter complex was cross-linked and purified for qRT-PCR.
Menses Cytometry
Pyroptosis was measured using flow cytometry in strict accord with the instructions of the FAM-FLICA Caspase Assay Kit (ImmunoChemistry Technologies, Bloomington, MN, Us).
47
- Hou L.
- Yang Z.
- Wang Z.
- Zhang X.
- Zhao Y.
- Yang H.
- Zheng B.
- Tian Westward.
- Wang Southward.
- He Z.
- Wang X.
NLRP3/ASC-mediated alveolar macrophage pyroptosis enhances HMGB1 secretion in astute lung injury induced by cardiopulmonary bypass.
- Crossref
- PubMed
- Scopus (54)
- Google Scholar
PI/Hoechst 33342 Double Staining
The cells were detached with 0.125% trypsin, with PI and Hoechst 33342 added, for double staining for 10 min. Adjacent, the cells were observed and photographed nether an inverted fluorescence microscope (Carl Zeiss, Oberkochen, Frg). PI could enter the nucleus through the membrane of apoptotic cells to showroom red fluorescence. The apoptotic rate was calculated every bit follows: (the number of apoptotic cells ÷ the total number of cells) × 100%.
Detection of MPO Activity
Lung tissue homogenates were mixed with thiobarbituric acrid, and the MPO activity in the supernatant was detected using a spectrophotometer by measuring the absorbance changes of lung tissues per gram.
48
- Chen Y.T.
- Du Y.
- Zhao B.
- Gan L.X.
- Yu K.K.
- Sunday L.
- Wang J.
- Qian F.
Costunolide alleviates HKSA-induced astute lung injury via inhibition of macrophage activation.
- Crossref
- PubMed
- Scopus (12)
- Google Scholar
H&E Staining
The right-side lungs of rats whose alveoli were not lavaged were fixed with formalin and paraffin-sectioned for H&E staining. After, the pathological changes in the tissue sections were observed nether an optical microscope.
Detection of Pulmonary Edema-Related Parameters
The left-side lungs without alveolar lavage were extracted from the rats, and the bloodstained water on the lung surface was sucked and dried to measure the wet weight (W) of the lungs. Subsequently that, the lungs were dried at 80°C for 48 h, followed by measurement of dry weight (D). Next, the W/D ratio and lung water content were calculated.
Immunohistochemistry
Tissue specimens were alkane-sectioned, deparaffinized into h2o, dehydrated using slope booze, and done with distilled h2o for ii min. Subsequently, the sections were treated with 3% H2Oii for xx min, done with distilled water for ii min, and rinsed with 0.1 Yard PBS for three min, followed by antigen retrieval in a water bath. Next, the sections were added with normal goat serum blocking solution (C-0005, Shanghai Haoran Bio Technologies, Shanghai, People's republic of china) at room temperature for 20 min. Following that, the sections were incubated overnight at iv°C with the main antibody rabbit NLRP3 (ab214185, dilution ratio of one:500), and incubated with the secondary antibody of caprine animal anti-rabbit immunoglobulin G (IgG; ab6785, dilution ratio of 1:1,000) at 37°C for 20 min. The same antibodies were purchased from Abcam (Cambridge, UK). The sections were added with HRP-labeled streptavidin protein working solution (0343-10000U, Imunbio Biotechnology, Beijing, China), incubated at 37°C for 20 min, and developed using diaminobenzidine (ST033, Guangzhou Weijia Technology, Guangzhou, Cathay). Subsequently, the sections were counterstained with hematoxylin (PT001, Shanghai Bogoo Bioechnology, Shanghai, Cathay) for 1 min and returned to bluish coloration using 1% ammonia. The staining was observed under a microscope.
Statistical Analysis
Statistical analyses were performed using the SPSS v21.0 software (IBM, Armonk, NY, USA). Measurement information were presented equally mean ± SD. An unpaired t exam was used to analyze the unpaired data between two groups conforming to normal distribution and homogeneity of variance. Comparisons among multiple groups were assessed using one-way ANOVA and subjected to Tukey's mail service hoc examination. Comparisons among multiple groups at dissimilar time points were assessed using repeated-measurement ANOVA and subjected to a Bonferroni post hoc test. The cistron relevance was analyzed using Pearson's correlation analysis. The survival rates of rats were calculated using the Kaplan-Meier method and unmarried-factor analysis was performed using the log-rank test. A value of p < 0.05 was considered to be statistically significant.
Author Contributions
Y.Y. and Y.G. designed the written report. Y.Thou. and Yard.Y. collated the data, designed and adult the database, carried out data analyses, and produced the initial draft of the manuscript. Y.Y. and M.Y. contributed to drafting the manuscript. All authors have read and approved the final submitted manuscript.
Conflicts of Involvement
The authors declare no competing interests.
Acknowledgments
The authors thank the reviewers for their helpful comments.
References
-
Sex, race, and the development of acute lung injury.
Chest. 2013; 143 : 901-909 -
Bioinformatics insights into acute lung injury/acute respiratory distress syndrome.
Clin. Transl. Med. 2012; 1 : ix -
Acute respiratory distress syndrome and astute lung injury.
Postgrad. Med. J. 2011; 87 : 612-622 -
Effective in vivo treatment of acute lung injury with helical, amphipathic peptoid mimics of pulmonary surfactant proteins.
Sci. Rep. 2018; viii : 6795 -
Acute lung injury: a clinical and molecular review.
Curvation. Pathol. Lab. Med. 2016; 140 : 345-350 -
Clinical review: Stem prison cell therapies for acute lung injury/astute respiratory distress syndrome—promise or hype?.
Crit. Care. 2012; 16 : 205 -
Risk factors for physical impairment after acute lung injury in a national, multicenter study.
Am. J. Respir. Crit. Care Med. 2014; 189 : 1214-1224 -
Diagnostic potential of extracellular microrna in respiratory diseases.
Clin. Rev. Allergy Immunol. 2018; 54 : 480-492 -
microRNA-1246 mediates lipopolysaccharide-induced pulmonary endothelial jail cell apoptosis and acute lung injury by targeting angiotensin-converting enzyme 2.
Am. J. Transl. Res. 2017; 9 : 1287-1296 -
MicroRNA-495 mimics commitment inhibits lung tumor progression.
Neoplasm Biol. 2015; 36 : 729-735 -
A small-scale-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases.
Nat. Med. 2015; 21 : 248-255 -
NLRP3 inflammasome plays a key role in the regulation of intestinal homeostasis.
Inflamm. Bowel Dis. 2011; 17 : 1359-1372 -
Isoflurane attenuates lipopolysaccharide-induced acute lung injury by inhibiting ROS-mediated NLRP3 inflammasome activation.
Am. J. Transl. Res. 2016; eight : 2033-2046 -
Resveratrol ameliorates LPS-induced acute lung injury via NLRP3 inflammasome modulation.
Biomed. Pharmacother. 2016; 84 : 130-138 -
Methylation-associated silencing of miR-495 inhibit the migration and invasion of human gastric cancer cells by direct targeting PRL-three.
Biochem. Biophys. Res. Commun. 2015; 456 : 344-350 -
Protective result of zerumbone reduces lipopolysaccharide-induced acute lung injury via antioxidative enzymes and Nrf2/HO-1 pathway.
Int. Immunopharmacol. 2017; 46 : 194-200 -
Biomarkers in acute lung injury: insights into the pathogenesis of acute lung injury.
Crit. Intendance Clin. 2011; 27 : 355-377 -
Atractylodin attenuates lipopolysaccharide-induced acute lung injury past inhibiting NLRP3 inflammasome and TLR4 pathways.
J. Pharmacol. Sci. 2018; 136 : 203-211 -
Blockage of P2X7 attenuates acute lung injury in mice by inhibiting NLRP3 inflammasome.
Int. Immunopharmacol. 2015; 27 : 38-45 -
Melatonin alleviates astute lung injury through inhibiting the NLRP3 inflammasome.
J. Pineal Res. 2016; lx : 405-414 -
Therapeutic effects of silibinin on LPS-induced astute lung injury by inhibiting NLRP3 and NF-κB signaling pathways.
Microb. Pathog. 2017; 108 : 104-108 -
Diosmetin alleviates lipopolysaccharide-induced astute lung injury through activating the nrf2 pathway and inhibiting the nlrp3 inflammasome.
Biomol. Ther. (Seoul). 2018; 26 : 157-166 -
Targeting il-ten family unit cytokines for the treatment of human diseases.
Cold Spring Harb. Perspect. Biol. 2019; eleven : a028548 -
Il-ten family unit cytokines il-x and il-22: From basic science to clinical translation.
Immunity. 2019; fifty : 871-891 -
The camp pathway amplifies early myd88-dependent and blazon i interferon-contained lps-induced interleukin-10 expression in mouse macrophages.
Mediators Inflamm. 2019; 2019 : 3451461 -
NOX2 deficiency alters macrophage phenotype through an IL-10/STAT3 dependent mechanism: implications for traumatic brain injury.
J. Neuroinflammation. 2017; xiv : 65 -
microRNA-520c-3p suppresses NLRP3 inflammasome activation and inflammatory cascade in preeclampsia by downregulating NLRP3.
Inflamm. Res. 2019; 68 : 643-654 -
MicroRNA-21 inhibits lipopolysaccharide-induced acute lung injury by targeting nuclear cistron-κB.
Exp. Ther. Med. 2018; 16 : 4616-4622 -
Deoxyribonucleic acid microarray-based screening of differentially expressed genes related to acute lung injury and functional analysis.
Eur. Rev. Med. Pharmacol. Sci. 2013; 17 : 1044-1050 -
The regulation of microRNA expression past DNA methylation in hepatocellular carcinoma.
Mol. Biosyst. 2015; 11 : 532-539 -
DNA methylation and microRNA dysregulation in cancer.
Mol. Oncol. 2012; 6 : 567-578 -
Inhibition of DNA methylation with zebularine alters lipopolysaccharide-induced sickness behavior and neuroinflammation in mice.
Forepart. Neurosci. 2018; 12 : 636 -
Genome-wide assay of Dna methylation in rat lungs with lipopolysaccharide-induced astute lung injury.
Mol. Med. Rep. 2013; 7 : 1417-1424 -
Demethylation of miR-495 inhibits prison cell proliferation, migration and promotes apoptosis past targeting STAT-3 in breast cancer.
Oncol. Rep. 2017; 37 : 3581-3589 -
MiR-495 regulates proliferation and migration in NSCLC by targeting MTA3.
Tumour Biol. 2014; 35 : 3487-3494 -
Cutting edge: miR-223 and EBV miR-BART15 regulate the NLRP3 inflammasome and IL-1β production.
J. Immunol. 2012; 189 : 3795-3799 -
NLRP3 inflammasome activity is negatively controlled past miR-223.
J. Immunol. 2012; 189 : 4175-4181 -
Microrna-495 ameliorates cardiac microvascular endothelial cell injury and inflammatory reaction by suppressing the nlrp3 inflammasome signaling pathway.
Cell. Physiol. Biochem. 2018; 49 : 798-815 -
MicroRNA-495 inhibits the high glucose-induced inflammation, differentiation and extracellular matrix accumulation of cardiac fibroblasts through downregulation of NOD1.
Cell. Mol. Biol. Lett. 2018; 23 : 23 -
Upregulation of miR-146a contributes to the suppression of inflammatory responses in LPS-induced acute lung injury.
Exp. Lung Res. 2013; 39 : 275-282 -
Activation of NLRP3 inflammasome in alveolar macrophages contributes to mechanical stretch-induced lung inflammation and injury.
J. Immunol. 2013; 190 : 3590-3599 -
The effects of morin on lipopolysaccharide-induced acute lung injury past suppressing the lung NLRP3 inflammasome.
Inflammation. 2014; 37 : 1976-1983 -
MicroRNA-495 inhibits the progression of non-small-cell lung cancer by targeting TCF4 and inactivating Wnt/β-catenin pathway.
Eur. Rev. Med. Pharmacol. Sci. 2018; 22 : 7750-7759 -
Protective effects of ethyl gallate and pentagalloylglucose, the agile components of Qingwen Baidu Decoction, against lipopolysaccharide-induced astute lung injury in rats.
Drug Des. Devel. Ther. 2018; 13 : 71-77 -
PAX3-FOXO1 escapes miR-495 regulation during muscle differentiation.
RNA Biol. 2019; xvi : 144-153 -
Fast chromatin immunoprecipitation analysis.
Nucleic Acids Res. 2006; 34 : e2 -
NLRP3/ASC-mediated alveolar macrophage pyroptosis enhances HMGB1 secretion in astute lung injury induced by cardiopulmonary bypass.
Lab. Invest. 2018; 98 : 1052-1064 -
Costunolide alleviates HKSA-induced acute lung injury via inhibition of macrophage activation.
Acta Pharmacol. Sin. 2019; 40 : 1040-1048 -
Autophagy activation improves lung injury and inflammation in sepsis.
Inflammation. 2019; 42 : 426-439
Commodity Info
Publication History
Published online: October 03, 2019
Accepted: Baronial 17, 2019
Received: April 18, 2019
Identification
DOI: https://doi.org/x.1016/j.omtn.2019.08.028
Copyright
© 2019 The Authors.
User License
Creative Eatables Attribution – NonCommercial – NoDerivs (CC Past-NC-ND 4.0) |How you tin reuse
Permitted
For non-commercial purposes:
- Read, print & download
- Redistribute or republish the final article
- Text & data mine
- Translate the article (private utilize only, not for distribution)
- Reuse portions or extracts from the article in other works
Not Permitted
- Sell or re-utilise for commercial purposes
- Distribute translations or adaptations of the article
Elsevier's open access license policy
ScienceDirect
Access this commodity on ScienceDirect- View Large Paradigm
- Download Hello-res prototype
Related Articles
Prison cell Press commenting guidelines
To submit a comment for a journal article, please use the space above and notation the following:
- We will review submitted comments within 2 business organization days.
- This forum is intended for constructive dialog. Comments that are commercial or promotional in nature, pertain to specific medical cases, are not relevant to the article for which they have been submitted, or are otherwise inappropriate will not be posted.
- We recommend that commenters identify themselves with full names and affiliations.
- Comments must be in compliance with our Terms & Conditions.
- Comments will not be peer-reviewed.
Source: https://www.cell.com/molecular-therapy-family/nucleic-acids/fulltext/S2162-2531(19)30273-2
0 Response to "Stem Cell Therapy – Hype or Hope? A Review"
Post a Comment